Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 2834073
End position: 2834096
Length: 24

DNA sequence
>NC_019738, from 2834073 to 2834096 (24 bp); Microcoleus sp. PCC 7113 GCTCCCCCGCTCCCCCGCTCCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2832911-2834425	Sequence	Mic7113_2461 - hypothetical protein (Protein is coded in complementary strand; from 2834425 to 2832911)