Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 289377
End position: 289404
Length: 28

DNA sequence
>NC_019738, from 289377 to 289404 (28 bp); Microcoleus sp. PCC 7113 GGTAATGGGTAATGGGTAATGGGTAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 288918-289382	Sequence	Mic7113_0261 - response regulator containing a CheY-like receiver domain and a GGDEF domain
ORF... 289403-290203	Sequence	Mic7113_0262 - putative hydrolase or acyltransferase of alpha/beta superfamily