Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 2922334
End position: 2922363
Length: 30

DNA sequence
>NC_019738, from 2922334 to 2922363 (30 bp); Microcoleus sp. PCC 7113 TCTTCCTCTTCTTCTTTCTCCTCCTGTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2921407-2923485	Sequence	Mic7113_2542 - protoporphyrin IX magnesium-chelatase (Protein is coded in complementary strand; from 2923485 to 2921407)