Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3298838
End position: 3298873
Length: 36

DNA sequence
>NC_019738, from 3298838 to 3298873 (36 bp); Microcoleus sp. PCC 7113 GGCGAGGGTGAGGGTGACGGTGAGGGTGAGGCTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3298466-3300505	Sequence	Mic7113_2849 - serine/threonine protein kinase (Protein is coded in complementary strand; from 3300505 to 3298466)