Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3340510
End position: 3340554
Length: 45

DNA sequence
>NC_019738, from 3340510 to 3340554 (45 bp); Microcoleus sp. PCC 7113 GTGCTGCCACCACCCGTGCTGCCACCACCCGTGCTGCCACCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3339406-3341901	Sequence	Mic7113_2887 - hypothetical protein (Protein is coded in complementary strand; from 3341901 to 3339406)