Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 340123
End position: 340167
Length: 45

DNA sequence
>NC_019738, from 340123 to 340167 (45 bp); Microcoleus sp. PCC 7113 CCCCTCAGGTTGGCACCTCTGAGATTGGCACCTCTGAGATTGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 339361-340443	Sequence	Mic7113_0303 - putative low-complexity protein (Protein is coded in complementary strand; from 340443 to 339361)