Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 343879
End position: 343906
Length: 28

DNA sequence
>NC_019738, from 343879 to 343906 (28 bp); Microcoleus sp. PCC 7113 GGCTTGGGGATTGGGACTTGGGGATTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 342905-344707	Sequence	Mic7113_0306 - response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain (Protein is coded in complementary strand; from 344707 to 342905)