Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3487748
End position: 3487782
Length: 35

DNA sequence
>NC_019738, from 3487748 to 3487782 (35 bp); Microcoleus sp. PCC 7113 TTCCCCACTCCCCATTCCCCATTCCCCATTCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3484911-3488240	Sequence	Mic7113_3009 - type 2 lantibiotic biosynthesis protein LanM (Protein is coded in complementary strand; from 3488240 to 3484911)