Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3539872
End position: 3539899
Length: 28

DNA sequence
>NC_019738, from 3539872 to 3539899 (28 bp); Microcoleus sp. PCC 7113 ATTGGTCATTAGTCATTAGTCATTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3539325-3539873	Sequence	Mic7113_3066 - coenzyme F420-reducing hydrogenase, gamma subunit