Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3542933
End position: 3542960
Length: 28

DNA sequence
>NC_019738, from 3542933 to 3542960 (28 bp); Microcoleus sp. PCC 7113 GGCAGAGGGGAGAGGGCAGAGGGCAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3542806-3543681	Sequence	Mic7113_3071 - Hydrogenase nickel incorporation protein HypB