Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3545377
End position: 3545404
Length: 28

DNA sequence
>NC_019738, from 3545377 to 3545404 (28 bp); Microcoleus sp. PCC 7113 CCTTCTGCCCTCTGCCCTCTGCCATCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3543710-3546274	Sequence	Mic7113_3072 - (NiFe) hydrogenase maturation protein HypF