Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3791381
End position: 3791434
Length: 54

DNA sequence
>NC_019738, from 3791381 to 3791434 (54 bp); Microcoleus sp. PCC 7113 TTGATTCCTTTGATGATATTGATTCCTTTGATGATATTGATTCCTTTGATGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3789884-3792265	Sequence	Mic7113_3306 - filamentous hemagglutinin family N-terminal domain protein