Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3796547
End position: 3796570
Length: 24

DNA sequence
>NC_019738, from 3796547 to 3796570 (24 bp); Microcoleus sp. PCC 7113 CGAAACCACCAAACCACAAAACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3796376-3799555	Sequence	Mic7113_3309 - putative transmembrane sensor domain protein (Protein is coded in complementary strand; from 3799555 to 3796376)