Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 379853
End position: 379880
Length: 28

DNA sequence
>NC_019738, from 379853 to 379880 (28 bp); Microcoleus sp. PCC 7113 AATCCAAAATCTAAAATCCAAAATCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 378987-381578	Sequence	Mic7113_0337 - transcriptional regulators containing an AAA-type ATPase domain and a DNA-binding domain