Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3823269
End position: 3823313
Length: 45

DNA sequence
>NC_019738, from 3823269 to 3823313 (45 bp); Microcoleus sp. PCC 7113 CCCGTAGGTTCGCCTCTCGCAGGTTCGCCTTCATTAGGTTCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3823124-3823627	Sequence	Mic7113_3334 - putative low-complexity protein (Protein is coded in complementary strand; from 3823627 to 3823124)