Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 3908057
End position: 3908101
Length: 45

DNA sequence
>NC_019738, from 3908057 to 3908101 (45 bp); Microcoleus sp. PCC 7113 ACAACTCAGTTCGGCACCACTCAGGTTGGCACCACTCAGGTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3907164-3908399	Sequence	Mic7113_3394 - putative low-complexity protein (Protein is coded in complementary strand; from 3908399 to 3907164)