Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4174334
End position: 4174368
Length: 35

DNA sequence
>NC_019738, from 4174334 to 4174368 (35 bp); Microcoleus sp. PCC 7113 GTGATGGGTGATGGGTAATGGGTAATGGGTAATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4173487-4174338	Sequence	Mic7113_3605 - ABC-type spermidine/putrescine transport system, permease component II