Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 426699
End position: 426726
Length: 28

DNA sequence
>NC_019738, from 426699 to 426726 (28 bp); Microcoleus sp. PCC 7113 CCTTTTGCCTTCTGCCCTTTGCCTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 425691-426779	Sequence	Mic7113_0374 - ABC-type metal ion transport system, periplasmic component/surface adhesin (Protein is coded in complementary strand; from 426779 to 425691)