Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4405060
End position: 4405104
Length: 45

DNA sequence
>NC_019738, from 4405060 to 4405104 (45 bp); Microcoleus sp. PCC 7113 CATGCTTCCCTTCGGGACGCTTCCCTCCGGGACGCTTCCCTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4403348-4405291	Sequence	Mic7113_3795 - PAS domain S-box (Protein is coded in complementary strand; from 4405291 to 4403348)