Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4598009
End position: 4598044
Length: 36

DNA sequence
>NC_019738, from 4598009 to 4598044 (36 bp); Microcoleus sp. PCC 7113 ATGACAACGACCATGACAACGACCATGACAACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4596926-4599280	Sequence	Mic7113_3959 - putative transmembrane sensor domain protein