Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4677047
End position: 4677076
Length: 30

DNA sequence
>NC_019738, from 4677047 to 4677076 (30 bp); Microcoleus sp. PCC 7113 CCAAGCCCAAGCCCAAGCCCAAGCCCAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4676784-4677551	Sequence	Mic7113_4013 - hypothetical protein (Protein is coded in complementary strand; from 4677551 to 4676784)