Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4712596
End position: 4712637
Length: 42

DNA sequence
>NC_019738, from 4712596 to 4712637 (42 bp); Microcoleus sp. PCC 7113 ATTGGTGATTGGTAATCGGTAATTGGTAATTGGTCATTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4709278-4714731	Sequence	Mic7113_4041 - putative ATPase (Protein is coded in complementary strand; from 4714731 to 4709278)