Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 473294
End position: 473329
Length: 36

DNA sequence
>NC_019738, from 473294 to 473329 (36 bp); Microcoleus sp. PCC 7113 GACATCATCATCGAGATCATCATCATCATCATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 473292-473525	Sequence	Mic7113_0425 - endo-beta-mannanase (Protein is coded in complementary strand; from 473525 to 473292)