Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4835513
End position: 4835536
Length: 24

DNA sequence
>NC_019738, from 4835513 to 4835536 (24 bp); Microcoleus sp. PCC 7113 CCATTGCCATTGCCATTGCCATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4834004-4835659	Sequence	Mic7113_4138 - multidrug resistance efflux pump (Protein is coded in complementary strand; from 4835659 to 4834004)