Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4887206
End position: 4887233
Length: 28

DNA sequence
>NC_019738, from 4887206 to 4887233 (28 bp); Microcoleus sp. PCC 7113 TTGAACTTTCAACTTTCAACTTTCAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4887229-4889607	Sequence	Mic7113_4178 - putative transmembrane sensor domain protein (Protein is coded in complementary strand; from 4889607 to 4887229)