Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 4968773
End position: 4968800
Length: 28

DNA sequence
>NC_019738, from 4968773 to 4968800 (28 bp); Microcoleus sp. PCC 7113 ATACTTCATACTTTATCCTTCATACCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4968793-4969458	Sequence	Mic7113_4240 - hypothetical protein (Protein is coded in complementary strand; from 4969458 to 4968793)