Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 5020831
End position: 5020860
Length: 30

DNA sequence
>NC_019738, from 5020831 to 5020860 (30 bp); Microcoleus sp. PCC 7113 ATGGTCATGGTCATGGTCATGGTCATGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5020487-5021617	Sequence	Mic7113_4285 - putative GTPase, G3E family (Protein is coded in complementary strand; from 5021617 to 5020487)