Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 5474078
End position: 5474112
Length: 35

DNA sequence
>NC_019738, from 5474078 to 5474112 (35 bp); Microcoleus sp. PCC 7113 CTTCTGCCTTCTGCCTCCTGCCTTCTGCCTTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5474113-5474304	Sequence	Mic7113_4675 - hypothetical protein (Protein is coded in complementary strand; from 5474304 to 5474113)