Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 561728
End position: 561775
Length: 48

DNA sequence
>NC_019738, from 561728 to 561775 (48 bp); Microcoleus sp. PCC 7113 TGGAGAGGGAGTTGGAGAGGGAGTTGGAGAGGGAGTTGGAGAGGGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 561513-562736	Sequence	Mic7113_0491 - putative peptidoglycan-binding domain-containing protein (Protein is coded in complementary strand; from 562736 to 561513)