Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 5967106
End position: 5967159
Length: 54

DNA sequence
>NC_019738, from 5967106 to 5967159 (54 bp); Microcoleus sp. PCC 7113 TGGTGAGGGACTCGGTGACGGTGAGGGACTGGGGGATGGTGAAGGACTGGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5965217-5967559	Sequence	Mic7113_5090 - outer membrane protein/protective antigen OMA87 (Protein is coded in complementary strand; from 5967559 to 5965217)