Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6002476
End position: 6002503
Length: 28

DNA sequence
>NC_019738, from 6002476 to 6002503 (28 bp); Microcoleus sp. PCC 7113 GATTTTGGATGTTGGATGTTGGATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6001629-6004736	Sequence	Mic7113_5118 - hypothetical protein (Protein is coded in complementary strand; from 6004736 to 6001629)