Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6038287
End position: 6038310
Length: 24

DNA sequence
>NC_019738, from 6038287 to 6038310 (24 bp); Microcoleus sp. PCC 7113 CCTGAACCCGAACCCGAACCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6037561-6038868	Sequence	Mic7113_5148 - putative S-layer protein (Protein is coded in complementary strand; from 6038868 to 6037561)