Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6185546
End position: 6185580
Length: 35

DNA sequence
>NC_019738, from 6185546 to 6185580 (35 bp); Microcoleus sp. PCC 7113 AATGATCAATGATGAATGACCAATGACCGATGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6184701-6185558	Sequence	Mic7113_5275 - putative glycosyltransferase
ORF... 6185569-6186777	Sequence	Mic7113_5276 - glycosyltransferase