Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6303234
End position: 6303287
Length: 54

DNA sequence
>NC_019738, from 6303234 to 6303287 (54 bp); Microcoleus sp. PCC 7113 CCCATGCCGCCCATGCCGCCCATGCCGCCCATGCCGCCCATGCCGCCCATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6303225-6304898	Sequence	Mic7113_5380 - chaperonin GroL (Protein is coded in complementary strand; from 6304898 to 6303225)