Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6500581
End position: 6500604
Length: 24

DNA sequence
>NC_019738, from 6500581 to 6500604 (24 bp); Microcoleus sp. PCC 7113 TCATCAGCATCATCATCATCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6500575-6504630	Sequence	Mic7113_5557 - DNA-directed RNA polymerase subunit beta' (Protein is coded in complementary strand; from 6504630 to 6500575)