Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6520541
End position: 6520567
Length: 27

DNA sequence
>NC_019738, from 6520541 to 6520567 (27 bp); Microcoleus sp. PCC 7113 GAGGGCAAGGAGGACAAGGAGGACAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6519842-6522496	Sequence	Mic7113_5567 - type I secretion system ABC transporter, HlyB family