Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 653544
End position: 653571
Length: 28

DNA sequence
>NC_019738, from 653544 to 653571 (28 bp); Microcoleus sp. PCC 7113 TATATTTTAGATTTTAGATTTTAGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 653551-653664	Sequence	Mic7113_0569 - hypothetical protein (Protein is coded in complementary strand; from 653664 to 653551)