Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6558735
End position: 6558761
Length: 27

DNA sequence
>NC_019738, from 6558735 to 6558761 (27 bp); Microcoleus sp. PCC 7113 GTCGATGTCGTCGATTTCGTCAATGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6558697-6559506	Sequence	Mic7113_5601 - ribosomal protein S2 (Protein is coded in complementary strand; from 6559506 to 6558697)