Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6824580
End position: 6824603
Length: 24

DNA sequence
>NC_019738, from 6824580 to 6824603 (24 bp); Microcoleus sp. PCC 7113 TGCCTGTGCCTGTGCCTGTGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6824168-6825175	Sequence	Mic7113_5841 - hypothetical protein (Protein is coded in complementary strand; from 6825175 to 6824168)