Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6882718
End position: 6882762
Length: 45

DNA sequence
>NC_019738, from 6882718 to 6882762 (45 bp); Microcoleus sp. PCC 7113 GTTAGCACCGCTCAAATTCGCCCCGCTCAAGTTAGCATTACTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6882275-6884482	Sequence	Mic7113_5884 - putative low-complexity protein (Protein is coded in complementary strand; from 6884482 to 6882275)