Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 6897450
End position: 6897473
Length: 24

DNA sequence
>NC_019738, from 6897450 to 6897473 (24 bp); Microcoleus sp. PCC 7113 CGGCTTTGGCTTCCGCTTCGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6897377-6898783	Sequence	Mic7113_5898 - restriction endonuclease S subunit (Protein is coded in complementary strand; from 6898783 to 6897377)