Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 7119402
End position: 7119429
Length: 28

DNA sequence
>NC_019738, from 7119402 to 7119429 (28 bp); Microcoleus sp. PCC 7113 CCACTCCCAACTCCCGACTCCCGACTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7117839-7120496	Sequence	Mic7113_6093 - hypothetical protein (Protein is coded in complementary strand; from 7120496 to 7117839)