Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 7147123
End position: 7147146
Length: 24

DNA sequence
>NC_019738, from 7147123 to 7147146 (24 bp); Microcoleus sp. PCC 7113 GAAAAAGACAAAGAAAAAGAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7146806-7147156	Sequence	Mic7113_6121 - protein of unknown function (DUF1816) (Protein is coded in complementary strand; from 7147156 to 7146806)