Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 7165077
End position: 7165100
Length: 24

DNA sequence
>NC_019738, from 7165077 to 7165100 (24 bp); Microcoleus sp. PCC 7113 GGGGATGGGGATGGTGATGGTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7164795-7165505	Sequence	Mic7113_6138 - hypothetical protein (Protein is coded in complementary strand; from 7165505 to 7164795)