Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 7202555
End position: 7202582
Length: 28

DNA sequence
>NC_019738, from 7202555 to 7202582 (28 bp); Microcoleus sp. PCC 7113 GGATTTTGAATTTTAGATTTTGGATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7202423-7205335	Sequence	Mic7113_6171 - filamentous hemagglutinin family N-terminal domain protein (Protein is coded in complementary strand; from 7205335 to 7202423)