Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 7345453
End position: 7345497
Length: 45

DNA sequence
>NC_019738, from 7345453 to 7345497 (45 bp); Microcoleus sp. PCC 7113 ATCAGCGCCACTCAGATTCGCGCCACTCAGATTTGCCCCACTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7345052-7346119	Sequence	Mic7113_6282 - putative low-complexity protein (Protein is coded in complementary strand; from 7346119 to 7345052)