Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 7356852
End position: 7356896
Length: 45

DNA sequence
>NC_019738, from 7356852 to 7356896 (45 bp); Microcoleus sp. PCC 7113 CGCACCACTTAAGTCCGCCGCACATAAGTCGGCACCACTCAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7356259-7357017	Sequence	Mic7113_6292 - putative low-complexity protein (Protein is coded in complementary strand; from 7357017 to 7356259)