Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 7371770
End position: 7371794
Length: 25

DNA sequence
>NC_019738, from 7371770 to 7371794 (25 bp); Microcoleus sp. PCC 7113 TTGAGTAGAGTTGAATTGAGTTAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7371339-7373687	Sequence	Mic7113_6303 - hypothetical protein (Protein is coded in complementary strand; from 7373687 to 7371339)