Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 87280
End position: 87333
Length: 54

DNA sequence
>NC_019738, from 87280 to 87333 (54 bp); Microcoleus sp. PCC 7113 AGTCTGTGACCCATTATTTCTCTGTGACCCATTATTTCTCTGTGGCCCATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 86768-87766	Sequence	Mic7113_0082 - hypothetical protein (Protein is coded in complementary strand; from 87766 to 86768)