Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 972062
End position: 972106
Length: 45

DNA sequence
>NC_019738, from 972062 to 972106 (45 bp); Microcoleus sp. PCC 7113 CTCAAGGTTGGCTCCCTCAAAGTTAGCTCCTGTAAGGTTGGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 971922-972833	Sequence	Mic7113_0848 - putative low-complexity protein (Protein is coded in complementary strand; from 972833 to 971922)